Sequence Browser

Sequence Detail Information

HQ206926

Isolate

PD328; Ca.63 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Actin

Genbank Accession Number

HQ206926

Sequence

526 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
GGTAGGTTATCCGTCATGATGCCCCAAAGCTTGTCCCATCGAGATGCTGTCCATATCATCTCTGAAGGACTCGATGCTCA
AGCAGTACATATTGCTAACAACATCTTCCCGTTACAGAAGAAGTTGCTGCCCTCGTCATTGACAATGGGTTCGTCTAATC
CCCCCCTTTTTTTCGCCCGCTGCTGTCGCCGGCTTCTCCGCCTTTGATGAGGGACCCGCCGCGATCCTTCATCACTCGAC
AACCACATACTGGCACAATGTCTCAACACATGGAGGGCCATGATAAGCAGAGGCAAGAAAAGAAACACGGAGCTGACTTG
ACTGTAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCCGTGCTGTCTTCCGTAAGTTCCCCTACCCA
ATTTCCCTAGACCGCAACTTTGGGTGCTGCGGGCAAAGCTCATCATGATCTTTGATGCTGACCATTTCAAGCTTCCATTG
TCGGTCGCCCCCGTCACCATGGTATCATGATTGGTATGGGCCAGAA

Comment