Sequence Browser

Sequence Detail Information

JN188090

Isolate

PD343; Cs.234 (Verticillium isaacii)

Source(s) and alternative IDs

  • N/A

Marker

Actin

Genbank Accession Number

JN188090

Sequence

505 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
GAGGGTAGGTCATCCATCGTCCACCAAACCTGGCCATCGAGATGTCGTCGACATCATCTCTTGCCAGCCGGCGCTTTCTT
TTGGAACACGGCTGACAACTTGTCCTCAATATAGAAGAAGTCGCTGCCCTCGTCATCGACAATGGGTCAGTTCATCTCCC
CCCTTTTTGCCCGCCACCGTCGCCGGCTTCTCCGCCCGTGATAGGGACCCGCCGGAATCCCTCACCACCCGACACTGGCA
CAATGCCTCAACGCTCGGAGGGCACAAAGAGAAAAGAAAGAAGATGAATAGGAAAGCTGACCTCTGCGTAGTTCGGGTAT
GTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCCGTGCTGTCTTCCGTAAGTTCCTCCCCAAGCCTCCAGACCGCAACT
TGGCTGTTGCGGGCAAAGCTGGTCATCAACCCGATGCTGACCATCCATAGCTTCCATCGTCGGTCGTCCCCGTCACCATG
GTATCATGATCGGTATGGGCCAGAA

Isolates carrying the same sequence to this isolate

Comment