Sequence Browser

Sequence Detail Information

JN188091

Isolate

PD347; Cs.456 (Verticillium klebahnii)

Source(s) and alternative IDs

  • N/A

Marker

Actin

Genbank Accession Number

JN188091

Sequence

504 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
AGGGTAGGTCATCCATCGTCCACCAAACCTGGCCATCGAGATGTCGTCGACATCATCTCTTGCCAGCCGGCGCTATCCTT
TGGAACATGGCTGACAACTTGTCCTCAATACAGAAGAAGTCGCTGCCCTCGTCATCGACAATGGGTCAGTTCATCTCCCC
CCTTTTTGCCCGCCACCGTCGCCGGCTTCTCCGCCCGTGATAGGGACCCGCCGGAATCCCTCACCACCCGACACTGGCAC
AATGCCTCAACCCTCGGAGGGCACAAAGAGAAAAGAAAGAAGATGAACAGGAAAGCTGACCTCTGCGTAGTTCGGGTATG
TGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCCGTGCTGTCTTCCGTAAGTTCCCCCCCAAGCCTCCAGACCGCAACTT
GGCTGCTGCGGGCAAAGCTGGTCATCATCCCGATGCTGACCATCCATAGCTTCCATCGTCGGTCGTCCCCGTCACCATGG
TATCATGATCGGTATGGGCCAGAA

Comment