Sequence Browser

Sequence Detail Information

HQ206931

Isolate

PD348; Bob.70; 90-02 (Verticillium longisporum)

Source(s) and alternative IDs

  • N/A

Marker

Actin

Genbank Accession Number

HQ206931

Sequence

440 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
ACACATTGCTAACAACATCTTCCCGTTACAGAAGAAGTTGCTGCCCTCGTCATTGACAATGGGTTCGTCTAATCCCCCCC
TTTTTTTCGCCCGCTGCTGTCGCCGGCTTCTCCGCCTTTGATGAGGGACCCGCCGCGATCCTTCATCACTCGACAACCAC
ATACTGGCACAATGTCTCAACACATGGAGGGCCATGATAAGCAGAGGCAAGAAAAGAAACACGGAGCTGACTTGACTGTA
GTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCCGTGCTGTCTTCGGTAAGTTCCCCCACCCAATTTCC
CTAGACCGCAACTTTGGGTGCTGCGGGCAAAGCTCATCATGATCTTTGATGCTGACCATTTCAAGCTTCCATTGTCGGTC
GCCCCCGTCACTATGGTATCATGATTGGTATGGGCCAGAA

Isolates carrying the same sequence to this isolate

Comment