Sequence Browser

Sequence Detail Information

HQ206933

Isolate

PD353; Ms.102; VP-1 (Verticillium alfalfae)

Source(s) and alternative IDs

  • N/A

Marker

Actin

Genbank Accession Number

HQ206933

Sequence

528 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
GAGGGTAGGTTATCCGTTATGATGCCCCAAAGCTTGTCCCATCGAGATGTTGCCCATATCATCTCTGAGGGACTTGATGC
TCAGGCAATGAACATTGCTAACAACATCTTCCCGTTACAGAAGAAGTTGCTGCCCTCGTCATTGACAATGGGTTCGTCTA
ATCCCCCCCCTTTTTCGCCCGCCGCTGTCGCCGGCTTCTCCGCCTTTGATGAGGGACCCGCCGCGATCCTTCATCACTCG
ATATCCATATACTGGCACAATGTCTCAACACATGGAGCGCCATGATAAGCAGAGGCAAGAAAAGAAACATGGAGCTGACT
TGACTGTAGTTCGGGTATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCCGTGCTGTCTTCCGTAAGTTGCCCTACC
CCAATTCCCTAGACCGCAACTTTGGGTGCCGCGGGCAAAGCTCGTCATGATCTTCAATACTGACCATTTCAAGCTTCCAT
TGTCGGTCGCCCCCGTCACCATGGTATCATGATTGGTATGGGCCAGAA

Isolates carrying the same sequence to this isolate

Comment