Sequence Browser

Sequence Detail Information

HQ414628

Isolate

PD327; Ca.59; B; T2 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Translation elongation factor 1-alpha

Genbank Accession Number

HQ414628

Sequence

579 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
GGTCACTTGATCTACCAGTGCGGCGGTATCGACAAGCGTACGATTGAGAAGTTTGAGATAAGTGGAGCCCCTGCTTGAAT
CTACACATAATTCCCTTTGATTCCAAGAAAATATCATGTTTTCATGGTTTCCGACGGGTTGGCGGTGATTTTGCGCAGTT
TTCGGTCATGGCGGGGTGATTTTGCCCCACCTGGGGCCGAACTGCCAACATTCACCGACCGGCCCCACTTTCCCCACAAC
ACCACAACTCCGTCCTCTCCATCACCACAATCTTGTTCAGTTTGCTCCATGTCACTTGTATGAACGCTCAGCTAACTCCC
TCTTACAAGGAGGTACGTTTTACAGATTGTTCAAACCCTGCTGCCAGTTGTTTCGGCTCTGCATGCCCCGGTCACGCGCC
ACACGCTATCCCCGGCTGATCTCATGGATCATCACCACCAACCTCATTGAGGACGGTTTGATTGTCCATGACGATCAGCC
ATTGTCTCCCCCTTGTTCCCCTTTGATTCCATTCTTTTATGCTCTCTCCGTTGTCCCGGGACCCCACTAACACCCACAAG
GCCGCCGAACTTGGCAAGG

Isolates carrying the same sequence to this isolate

Comment