Sequence Browser

Sequence Detail Information

JN188217

Isolate

PD341; Ls.183 (Verticillium isaacii)

Source(s) and alternative IDs

  • N/A

Marker

Translation elongation factor 1-alpha

Genbank Accession Number

JN188217

Sequence

347 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
GGTCACTTGATCTACAAGTGCGGCGGTATCGACAAGCGTACCATCGAGAAGTTCGAGAAGGCACGTCATTTCCCCGGTTC
CTTTAAATTTTTCCAATTTTCTCTACACCATGGGTCAACTTGAGGGCATTTCGACCGTTTGCGATGTCGCGATGACCTCG
AGTTGTTTTGGCAGCGAGTTGGTGATGATGGCCCGTGCGCGGTTCTCAACCCCGCCGACCAGACCCACTTTCCGACTTGC
CTCTCTCAGACCTCAACTCTTTTTCTTCAACATGACGTCGTCATGCCTCAGTACTCTCACGAACAATTGCTAACCCCATG
TTTAGGAGGCTGCCGAGCTCGGCAAGG

Isolates carrying the same sequence to this isolate

Comment