Sequence Browser

Sequence Detail Information

HQ414634

Isolate

PD348; Bob.70; 90-02 (Verticillium longisporum)

Source(s) and alternative IDs

  • N/A

Marker

Translation elongation factor 1-alpha

Genbank Accession Number

HQ414634

Sequence

579 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
GGTCACTTGATCTACCAGTGCGGCGGTATCGACAAGCGTACGATTGAGAAGTTTGAGATAAGTGGAGCCCTTGCTTGATT
CTACACATAATTCCCTTTGATTCCAAGAAAATACCATGTTTTCATGGTTTCCGACGGGTTGGCGGTGATTTTGCGCAGTT
TTCGGTCATGGCGGGGTGATTTTACCCCACCTGGGGCCGAACTACCAACATTCACCGACCGGCTCCACTTTCCCCACAAC
ACCACAACTCCGTCCTCTCCATCACCACAATCTTGTTCAGTTTGCTCCATCTCACTTGTATGAACGCTCAGCTAACTCCC
TCTTACAAGGAGGTACGTTTTACAGATTGTTCAAACCCTGCTGCCAGTTGTTTCGGCTCTGCGTGCCCCGGTCACGCGCC
ACACGCTATCCCTGGCTGATCTCATGGATCATCACCACCAACCTCATTGAGGGCGGTTTGATTGTCCATGACGATCAGCC
ATTGTCTCCCCCTTGTTCCCCTTTGGTTCCATTCTTTTATGCTCTCTCCGTTGTCCCGGGACCCCACTAACACCCACAAG
GCCGCCGAACTTGGCAAGG

Comment