Sequence Browser

Sequence Detail Information

HQ414636

Isolate

PD353; Ms.102; VP-1 (Verticillium alfalfae)

Source(s) and alternative IDs

  • N/A

Marker

Translation elongation factor 1-alpha

Genbank Accession Number

HQ414636

Sequence

573 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
GGTCACTTGATCTACCAGTGCGGCGGTATCGACAAGCGTACGATCGAGAAGTTTGAGATAAGTGGAGCCCCTTGACACGT
TGTTCCCTTTGATTTCAAGGAGATATCTCATGGTTTTCATGGTTTCCGACGGGTTGGCGGTGATTTTGCACAGTTTTCGG
TCATGGCGGGGTGATTGTACCCCACCTGGTACCGAACTGCCAAACTCCACCGACCGGCCCCACTTTTCTCACAACACCAC
AACCCCGTCCACTCCATCACCACAATCCTTCTCAACTTGCTCCATCTCTTGTATGAACGCTCAGCTAACCCCCTCTTACA
AGGAGGTACGTGTTACAGATTATGCAAACCCTTTTGCCAGTTGTTGCGGCTCTGCGTGCCCCGGTCACGTGCCCCACGTT
ACCCCGGCTGATCTCATGGATCATCACCACCAACCTCATCGAGGACGGTTTGATTGTCCCATGACGATCAGCCATTGTCT
CCCCCTTGTCCCCTTTTGATTCCATTCTTTTCTGCCCTTTTCGTCGTCTCCGGGACCCCACTGACACCTACAAGGCCGCC
GAACTCGGCAAGG

Isolates carrying the same sequence to this isolate

Comment