Sequence Browser

Sequence Detail Information

HQ414721

Isolate

PD325; Cf.31 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Glyceraldehyde-3-phosphate dehydrogenase

Genbank Accession Number

HQ414721

Sequence

649 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
641
GAGCACTCCGATGTCGAGATCGTTGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTAAGTAACCCCCCCCCAAA
CCAAAGTCTCATGCCCCCTTCTTTTGTCTATCATGTGCTGGGGTTCTCCCCGGCCATGGTCTGACCATGTCTCAACCCCG
CCGCCCTCGGCAGTCAAGATGACCCCTTCACGACAACTGGACGGCGTTCCTTGAGCCCCAAGCACACACACACACGAGAC
ATATGGCTAACCTTTCCTCAGGCCTACATGCTCAAGTACGACTCCACCCACGGCGTCTTCAAGGGTGAGATCACCGAGGA
CGGTTCCTCCCTGACCGTCAACGGCAAGAAGGTCAAGTTCTACCAGGAGCGTGACCCCGCTGCCATCCCCTGGAGCGAGA
CCGGCGCCGAGTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGACAAGGCCGCCGCCCATCTCAAGGGTGGCGCC
AAGAAGGTCATCATCTCCGCCCCCTCGGCCGATGCCCCCATGTACGTGATGGGTGTTAACGAGAAGACCTACGACGGCAA
GGCCGACGTCATCTCCAACGCGTCGTGCACCACCAACTGCCTGGCTCCCCTCGCCAAGGTCATCAACGACAAGTTCACCA
TCGTTGAGG

Isolates carrying the same sequence to this isolate

Comment