Sequence Browser

Sequence Detail Information

HQ414726

Isolate

PD332; Le.78 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Glyceraldehyde-3-phosphate dehydrogenase

Genbank Accession Number

HQ414726

Sequence

609 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
GAGCACTCCGATGTCGAGATCGTTGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTAAGTAACCCCCCCAAACC
AAAGTCTCATGCCCCCTTCTTTTGTCTATCATGTGCTGGGGTTCTCCCCGGCCATGGTCTGACCATGTCTCAACCCCGCC
GCCCTCGGCAGTCAAGATGACCCCTTCACGACAACTGGACGGCGTTCCTTGAGCCCCAAGCACACACACACACGAGACAT
GGCTAACCTTTCCTCAGGCCTACATGCTCAAGTACGACTCCACCCACGGCGTCTTCAAGGGTGAGATCACCGAGGACGGT
TCCTCCCTGACCGTCAACGGCAAGAAGGTCAAGTTCTACCAGGAGCGTGACCCCGCTGCCATCCCCTGGAGCGAGACCGG
CGCCGAGTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGACAAGGCCGCCGCCCATCTCAAGGGTGGCGCCAAGA
AGGTCATCATCTCCGCCCCCTCGGCCGATGCCCCCATGTACGTGATGGGTGTCAACGAGAAGACCTACGACGGCAAGGCC
GACGTCATCTCCAACGCCTCGTGCACCACCAACTGCCTGGCTCCCCTCG

Comment