Sequence Browser

Sequence Detail Information

HQ414727

Isolate

PD337; Gh.101; MD-05 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Glyceraldehyde-3-phosphate dehydrogenase

Genbank Accession Number

HQ414727

Sequence

647 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
641
GAGCACTCCGATGTCGAGATCGTTGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTAAGTAACCCCCCCAAACC
AAAGTCTCATGCCCCCTTCTTTTGTCTATCATGTGCTGGGGTTCTCCCCGGCCATGGTCTGACCATGTCTCAACCCCGCC
GCCCTCGGCAGTCAAGATGACCCCTTCACGACAACTGGACGGCGTTCCTTGAGCCCCAAGCACACACACACACGAGACAT
ATGGCTAACCTTTCCTCAGGCCTACATGCTCAAGTACGACTCCACCCACGGCGTCTTCAAGGGTGAGATCACCGAGGACG
GTTCCTCCCTGACCGTCAACGGCAAGAAGGTCAAGTTCTACCAGGAGCGTGACCCCGCTGCCATCCCCTGGAGCGAGACC
GGCGCCGAGTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGACAAGGCCGCCGCCCATCTCAAGGGTGGCGCCAA
GAAGGTCATCATCTCCGCCCCCTCGGCCGATGCCCCCATGTACGTGATGGGTGTCAACGAGAAGACCTACGACGGCAAGG
CCGACGTCATCTCCAACGCCTCGTGCACCACCAACTGCCTGGCTCCCCTCGCCAAGGTCATCAACGACAAGTTCACCATC
GTTGAGG

Isolates carrying the same sequence to this isolate

Comment