Sequence Browser

Sequence Detail Information

HQ414911

Isolate

PD325; Cf.31 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Tryptophan synthase

Genbank Accession Number

HQ414911

Sequence

544 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
AGAACAGGGTGAGTTGAGTCCAGCCTCCATTTGCCCCTCTCCCCAATCGCGGGGCACTTTTTCCTCTGCCCCCGCCACCG
AACACACCACGCACGACGACATGGTCTCGAGAGCCCACAAGCTCAAGTCGAGGGGAAGACATGACTGACATAGCGATGAC
AGTCAGCCCTCGTGACCTATGTCACCGCCGGCTTTCCCACGGCCGAGGAGACGCCCGATATCCTCCTCGCCATGGAGAAG
GGTGGAGCTGGTGAGTCTTAACAATGGACCAGCCCTCGATAAGACTTCTCATCCTGACACAGCCAGATATCCTCGAGCTC
GGCGCGCCCTTCACAGACCCTATCGCCGACGGCCCGACCATTCAGACCTCCAACACAATTGCTCTGCAAAATGGCGTCAC
GATCGAGTCCACACTGAAGATGGTCAAGGATGCGAGGAGTAAGGGCCTCAAGGCGCCGGTTCTGCTGATGGGATACTACA
ACCCTCTCCTGAGTTACGGCGAGGAGAGGCTCCTCAACGACTGCGCTGACAGCGGCGTCAACGC

Isolates carrying the same sequence to this isolate

Comment