Sequence Browser

Sequence Detail Information

JN188024

Isolate

PD338; Ms.107 (Verticillium alfalfae)

Source(s) and alternative IDs

  • N/A

Marker

Tryptophan synthase

Genbank Accession Number

JN188024

Sequence

571 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
AGAACAGGGTGAGTCGAGTCCCACCTCCATTTGCCCCTCGTCCTCCAAATCGCGGGGCACTTTTTCCTTCACCCCGCCAC
CGAACACACCACGCACGATGGCATGGCCTCGAAAAATCCATCAGCTCTCGTCGACGGGAAAACGTAACTGACAAGCGATG
ACAGTCAGCCCTCGTGACATATGTCACCGCCGGCTTTCCTACGGCTGAGGAGACGCCTGATATTCTCCTCGCTATGGAGA
AGGGTGGAGCTGGTGAGTCTTGACGATGGATCAGTCCTCCATACGACTTTGATCCTGACATGGCCAGATATCCTCGAGCT
CGGCGCGCCCTTCACAGACCCTATCGCCGACGGCCCGACCATTCAGACCTCCAACACAATTGCTCTGCAAAATGGCGTCA
CCATCGAGTCCACACTGAAGATGGTCAAGGATGCGAGGAGTAAGGGCCTCAAGGCGCCAGTTCTGCTGATGGGATACTAC
AACCCTCTCTTGAGTTACGGCGAGGAGAGGCTCCTCAACGACTGCGCTGACAGCGGCGTCAATGGCTTCATCGTTGTCGA
CCTGCCGCCCG

Isolates carrying the same sequence to this isolate

Comment