Sequence Browser

Sequence Detail Information

JN188026

Isolate

PD343; Cs.234 (Verticillium isaacii)

Source(s) and alternative IDs

  • N/A

Marker

Tryptophan synthase

Genbank Accession Number

JN188026

Sequence

572 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
AGAACAGGGTAAGTCGAGTTCCGTCTTTTTTTGCCCCTCCTTCCAGATGGCGGGGCACTTTTTCCATGCCACCAAACACC
AATGATGACGACAACGACCCTCAAACATGTCTTCATGATTCTCACCCCAATGAAGCAAATCGCTGACTGGCCGTGATCGC
AGTCAGCCCTGGTGACCTATGTTACCGCCGGCTACCCGACCGCCGCCGAGACCCCCGGCATTCTCCTGGCCATGGAGAAG
GGCGGAGCTGGTAAGTCCTCTCGACGACTCCTCCCTCGTTCGCGACATCCCAGGGCTAATATGATCAGATATTCTCGAGC
TCGGCGCCCCGTTCACCGACCCGATCGCCGACGGCCCTACCATTCAGACCTCGAACACCGTCGCCCTGCAAAATGGTGTT
ACCATCGAGTCCACCCTCAAGATGGTCAAGGACGCGAGGAGTCAGGGCCTCAAGGCTCCGGTCCTGCTGATGGGATACTA
CAACCCGCTTCTCAGCTACGGCGAGGAGAGGCTCCTGAACGACTGCGCCGATTCTGGCGTCAACGGCTTCATCGTCGTCG
ACCTGCCCCCGG

Isolates carrying the same sequence to this isolate

Comment