Sequence Browser

Sequence Detail Information

HQ414814

Isolate

PD322; Ls.17 (Verticillium dahliae)

Source(s) and alternative IDs

  • N/A

Marker

Mitochondrial oxaloacetate transport protein

Genbank Accession Number

HQ414814

Sequence

601 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
CCTTCCCACGCTCCCCGTCCCTGGCTTTGCGCCGATGCTCTTCCCGGCCAGACCCAGCTGACTCTTTGTACAGCGCCTTC
CTCGCTGGTGGCATCGCCGCCTGCGGTGCCGTCACAGCCACACACCCTTTCGAGACGGTCAAGATCCGGTGCGTCCCCGT
TATGCGGATACGCATGTCTAGTATATTGAAGTCCTCGGCTGACCGTGACACGCGCCGAACAGGATGCAGCTTCAGGGCGA
GCTCCAGGACAAAGGCCATCAACCACACAAGTACAGAGGACCCCTCCAGGGAGTGTCGGTCATCGTGCGGAATGAAGGCG
TCAAGGGTATCTACAGGGGAATAGGGAGCGCATACATCTATCAAATCCTGCTCAACGGCTGCCGACTTGGTTTTTACGAG
CCCATGCGTGGCACCCTGACCAAGCTCGTGTTTGATGACAGCAAGGTCCAGAGCCTGGGCGTCAACATGATTTGCGGTGC
CGGCTCAGGTATCATCGGTGCCGCCATGGGCAGCCCGTTCTTTCTCGTCAAGACAAGACTGCAGAGCTTCTCGCCATTTC
TACCCGTCGGCACCCAGCACAACTACAAGAACGCATGGAAC

Isolates carrying the same sequence to this isolate

Comment