Sequence Browser

Sequence Detail Information

HQ415006

Isolate

PD348; Bob.70; 90-02 (Verticillium longisporum)

Source(s) and alternative IDs

  • N/A

Marker

MAT 6159 bp

Genbank Accession Number

HQ415006

Sequence

2238 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
641
721
801
881
961
1041
1121
1201
1281
1361
1441
1521
1601
1681
1761
1841
1921
2001
2081
2161
AGCAGGTTCTGTGATCTCGACAGCTTGATTGACAGCGGAGGGTACGACAAGTGGCTCAAATGTGGCGCCGTATACAGTTT
GAAACTGCGTGTTGTAGTTGATGGTGGGGTTTCGGGTGGCTATCTGCTGCATGGTGCGTCCTTGAAACATTGCCGTGATG
TCTTGCTGAGTGAGAGACTCCAGAAGAAGTTGAGGGGGGAGCGTAGCGAGGTAGGCCAGCAGGTTGGATCTGACTGACAT
GTCGGATAAGTCATGTTCAGGTCGGACACCGTCCATTTTGAAGACGAGGACTTCAGGCTTGGTTGATTGTGGTGTATCAG
TAAGAAGAGTCTGAAGAAACTGAGACTGAAAGCGATGAGCAGTTATCTATGTTGGACGGTCCAAGAGATGATACGAGTAT
TTAGGGGGGAGGAGGGGGGTCTTTCAGGCTGGGAGGGGACGAGCGTTGTGGCGACCAAAGCTGAGTTGTAGAAGAGAAGC
TGTAGAAGGGAAAGATTGTAGAAATAGGCCTGTAAAATAGACAAGGTACCACGGCAGGTACGCACCTACCTGTAGTGTCT
TGGGACACCCAGTAGCAGTAGTTTTGCTTCCCGGCGGCAGGTGGTATACAGGGAAGGCAGTGACGGTCACAGTGCCACGA
AACACTGTGTTCAGCCTCTGGTCCCGGTAGGGAGTGGGATGCGAGCCAGGTCGGCACAGCGCAGCGCACTCACTACTGGG
AGTATTCCTGTTCTTCATGTTTAGATTATGCCCCTTGAAGATAATCTGCATCCTCTTAAAGGAATCACTTCGCAGAGATG
AGCAAAGCTGCAGAATTACGGTGCCACACAACACGCTCACAACCTGGGGTTCTTCCGAGACAGGGACATCGTTGCTACGA
AGTTTCTGGTACTGCTATTCGACTCGAATTCGAACTTCTGAGGTGCGCGTACTTCCTGGATAACAGAATGATCGGTTGCC
CTTAAAGCTGTGCTCGCATGAAATAGCAATCCATCTACCCACAGTTACGCTCTCTGGAACGAAATTCAAATACAGAGTCT
TGACGGAGCAAGCACAAATATAGTGAATTGTGTCCTTGAGCAATACAATGAGCTAAAAAAAAACTAGCCCATATTGTCTA
CCTAGGTAGGTACCTAAGTATATCTCTTTCTGAAGACTGCTGCGTGCCTGCCCATTCTACAGTTGGCATACTGATATTCT
TGGTCACTGATGCTAACCATCGGGAAAGCACCTCACATAACTTTTGTAAAATTTTCGAGGCAACAACCAACCCAGTTTCT
TCCTACATTATACCTCAAAAGCTGGCGCCTTCCACAGCTCATTGCACCATCATCCGCTTCACTTTTTCTGAAACTGTCAA
CCTCCGCTCGCCAAGCTCAAAAGCTTTCCACCACCACTTTCTCCACGAGATCTCAGCTCAGAACGAGGTGCTGCCCTCTC
AGTCAAACAACTATTTATCACAACTTCCAGGAACATCACAACCATCGGCATACAGCAAGCACCTTCACACGTTCAGAATC
CCAACACAATCATGAGTGAAATGCAACGCCAAGCCGCATTTGTGGTCAATAACTCGAGGACAGAGTTAAGAATGTATTTG
TCTTTACAGATCACATTTGAGGCTGCCAAACGCGCGACAGATGAACTATCGTGAGGAAGTCCCGTTCCTCTTGGCTGGTC
ACAACTAACATCAGTTCTAGTGAGCGCAGTGGCCTCCCGGCCGTATTGATCATGGATCAAGACAATTGTCAGTGGATAAT
TGTCGCCTCAATGGCTGCTGTAGTTGAGTATCCTCATGTCGACAACGGTGGGCTATCGCGTCTTCTACGCTTCGGCAGTA
AATCTTACTGATATTCGCAGCTCCTGTTGTCAAACATGATCCTCCAGTCACCAGCCTCAAGCAGCCAATTCACCTCGACT
TCCCAAGCACTACCAAAGGGCAGAAACAGCAGGAGCATATTCCCCGTCCTCCTAACTCATGGATTCTTTACCGCCAGGCT
CATTCCCGTCGCATCCACGAGCAGAGTCCTGGTATGTCAGCTGGCGAAATATGTGAGTGCTCGTATGCATATTTCAAAGT
TGTGTCTAACAGACCTGATAGCCAAAGCGATTGCTGCCATGTGGCGAAACGAGTCCACCGATGTCAAGGATCATTACAAA
ACTCTCGCCGCTGCAAAGGCCCAGAAACACAAAGAGCGCTATCCAAATTACAAATTCAGAGCCTCTAAACATGGAGGC

Comment