Sequence Browser

Sequence Detail Information

JF343445

Isolate

PD348; Bob.70; 90-02 (Verticillium longisporum)

Source(s) and alternative IDs

  • N/A

Marker

Beta-tublin

Genbank Accession Number

JF343445

Sequence

626 bp
|......10|.......20|.......30|.......40|.......50|.......60|.......70|.......80|
+ 1
81
161
241
321
401
481
561
AAGTCATTCCCATTCCAGCCCAACACTCGACGCGTCTCTTTCCACCCATTCGGCCGCCCCTGAACTCTACCCCGCTGAGT
CCCGAATCACGTTGTCCCGACCTCGCCCGCGATCACGACGACACTCGAAGACGACGTCAATCCTGACCATGCTACACTCC
TCCTGAAGTCCATGAGCTGACCTCGGTTTTCCTCTCTCTTAGGTTCACCTCCAGACCGGCCAGTGCGTAAGTTATTCCCA
GTACTACTGCCTATTTTCGATTTGCGGGGCTAATCACTCGATGAACAGGGTAACCAGATCGGTGCTGCTTTCTGGCAGAA
CATCTCTGGCGAGCACGGCCTCGACAGCAATGGCGTGTATGCTTTCCCCTCCAGTCGCAAAACCCTACCGGGTTATGTCT
TTCCTGTAGACCGGTTACTGACGTGATGACAGCTACAACGGCACTTCCGAGCTCCAGCTCGAGCGCATGAACGTCTACTT
CAACGAGGTATGTCAATACGAACAGTCCGATGGATATCTCTCAGCAGCAATTGCTCATGGTTTTTTTTCAGGCCTCTGGC
AACAAGTACGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGCGCT

Comment